pegfp c1 vector (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
96
Structured Review
TaKaRa
pegfp c1 vector
Pegfp C1 Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 3285 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+c1+vector/pmCherry-C1+Vector/bio_rxiv__2025__11__26__690680-258-17-19
Average 96 stars, based on 3285 article reviews
Pegfp C1 Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 3285 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+c1+vector/pmCherry-C1+Vector/bio_rxiv__2025__11__26__690680-258-17-19
Average 96 stars, based on 3285 article reviews
pegfp c1 vector - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Inhibition of SQSTM1/p62 oligomerization and Keap1 sequestration by the Cullin-3 adaptor SHKBP1 Article Snippet: .. Resistant EGFP-SHKBP1 or 2xUBA-3xFLAG-SHKBP1 (2US) or GFP-SHKBP1 (F44A) were subcloned into the pCDH-CMV-MCS vector to yield the lentiviral plasmid. p62-related constructs were amplified from HA-p62, Addgene (28027), which was subcloned into Article Title: Tension-sensitive LINC-RhoA signaling prevents chromatin bridge breakage in cytokinesis. Article Snippet: Plasmids pGEX4T1/SRs3-11, pGEX4T1/SRs21-30, pGEX4T1/SRs3137, pGEX4T1/SRs38-47 and pGEX4T1/SRs48-54 coding, respectively, for spectrin repeats 3–11, 21–30, 31–37, 38–47 and 48–54 of human Nesprin-2 fused to GST were generated by PCR-amplifying the respective sequences from cDNA derived from human BE cells and inserting them into the pGEX4T1 vector (GE Healthcare) as XhoINotI fragments. .. Plasmids GFP:PDZdom, GFP:PDZ(RH), GFP:PDZ(DH/PH) and GFP:PDZ(C-term) coding, respectively, for amino acid sequences 1–219, 220–701, 702–1152 or 1168–1522 of human PDZ RhoGEF fused to GFP were generated by PCRamplifying the respective sequences from mCitrine-YFP-ARHGEF11 plasmid and inserting them into the Article Title: Inhibition of SQSTM1/p62 oligomerization and Keap1 sequestration by the Cullin-3 adaptor SHKBP1 Article Snippet: Reagents were obtained from the following sources: DSP (Dithiobis(succinimidyl propionate)), TCI America (TCD2473); MLN4924, Cayman (15217); MG-132, Selleckchem (S2619); GFP-Trap magnetic agarose, ChromoTek (gtma-20); Protein G Sepharose, BioVision (6511); Ni-NTA agarose, QIAGEN (133203974); Anti-HA magnetic beads, Thermo Scientific (88836); Anti-FLAG magnetic beads, made in-house from NHS magnetic beads, Nacalai USA (TAS8848N1141-10MG) and Anti DYKDDDDK tag, Fujifilm (012-22383); Lipofectamine 2000, Invitrogen (11668019); RNase A, Research Products International (R21750); Puromycin dihydrochloride, Sigma-Aldrich (P8833); Blasticidin S hydrochloride, 10 mg/ml in HEPES buffer, Alfa Aesar (J67216); cOmplete Protease Inhibitor Cocktail, Roche (5056489001); ProLong Diamond Antifade Mountant with DAPI, Thermo Fisher (P36971); Clarity Western ECL Substrate, Bio-Rad (1705061). .. The SHKBP1 cDNA (Gene ID: 92799, a gift from Haiyuan Yu, Cornell University) was cloned into the Article Title: Tension-sensitive LINC-RhoA signaling prevents chromatin bridge breakage in cytokinesis Article Snippet: Plasmids pGEX4T1/SRs3-11, pGEX4T1/SRs21-30, pGEX4T1/SRs31-37, pGEX4T1/SRs38-47 and pGEX4T1/SRs48-54 coding, respectively, for spectrin repeats 3–11, 21–30, 31–37, 38–47 and 48–54 of human Nesprin-2 fused to GST were generated by PCR-amplifying the respective sequences from cDNA derived from human BE cells and inserting them into the pGEX4T1 vector (GE Healthcare) as XhoI-NotI fragments. .. Plasmids GFP:PDZ dom , GFP:PDZ(RH), GFP:PDZ(DH/PH) and GFP:PDZ(C-term) coding, respectively, for amino acid sequences 1–219, 220–701, 702–1152 or 1168–1522 of human PDZ RhoGEF fused to GFP were generated by PCR-amplifying the respective sequences from mCitrine-YFP-ARHGEF11 plasmid and inserting them into the Article Title: Selective induction by statins of FAM134B-mediated sarcoplasmic reticulum (SR)-phagy degrades the SR calcium pump SERCA1 and contributes to myopathy Article Snippet: The coding sequence of mouse SERCA1 was cloned into p3XFlag-CMV-7.1 vector (Sigma) at the NotI/XbaI site to generate pFLAG-SERCA1. .. To generate EGFP-SERCA1 and pmCherry-EGFP-SERCA1 expression plasmids, coding region of mouse SERCA1 was first cloned into the Article Title: Spuriously transcribed RNAs from CRISPR-sgRNA expression plasmids scaffold biomolecular condensate formation and hamper accurate genomic imaging Article Snippet: To generate the Streptococcus pyogenes dCas9 expression plasmid pdCas9, the coding region of dCas9 was first PCR amplified from pSLQ1658-dCas9-EGFP, a gift from Dr. Bo Huang and Dr. Stanley Qi (Addgene plasmid #51023) [ ], using forward primer 5′- ACTGCTGCTAGCGCTACCGGTCGCCACCATGGTGCCCAAAAAGAAGAGG-3′ and reverse primer 5′-ACCTGCGAATTCTTAGAACAGCTCCTCGCCC-3′. .. The PCR product was then inserted into the Construct:Article Title: Inhibition of SQSTM1/p62 oligomerization and Keap1 sequestration by the Cullin-3 adaptor SHKBP1 Article Snippet: .. Resistant EGFP-SHKBP1 or 2xUBA-3xFLAG-SHKBP1 (2US) or GFP-SHKBP1 (F44A) were subcloned into the pCDH-CMV-MCS vector to yield the lentiviral plasmid. p62-related constructs were amplified from HA-p62, Addgene (28027), which was subcloned into Amplification:Article Title: Inhibition of SQSTM1/p62 oligomerization and Keap1 sequestration by the Cullin-3 adaptor SHKBP1 Article Snippet: .. Resistant EGFP-SHKBP1 or 2xUBA-3xFLAG-SHKBP1 (2US) or GFP-SHKBP1 (F44A) were subcloned into the pCDH-CMV-MCS vector to yield the lentiviral plasmid. p62-related constructs were amplified from HA-p62, Addgene (28027), which was subcloned into Article Title: Expression Analysis of Heavy-Chain-Only Antibodies in Cloudy Catshark and Japanese Bullhead Shark Article Snippet: .. The amplified PCR fragments were digested with EcoRI (Cat. No.: 1040A, Takara Bio Inc., Kusatsu, Shiga, Japan) and XhoI (Cat. No.: 1094A, Takara Bio Inc.) and then cloned into the Polymerase Chain Reaction:Article Title: UCHL1-Mediated Spastin Degradation Regulates Microtubule Severing and Hippocampal Neurite Outgrowth. Article Snippet: As a key component of the cytoskeleton, microtubule dynamic provides structural support for neurite outgrowth.. Spastin, a microtubule severing enzyme associated with hereditary spastic paraplegia (HSP), is crucial for the growth and branching of neuronal processes.. Thus, the activity and function of spastin need to be strictly regulated. Article Title: Expression Analysis of Heavy-Chain-Only Antibodies in Cloudy Catshark and Japanese Bullhead Shark Article Snippet: .. The amplified PCR fragments were digested with EcoRI (Cat. No.: 1040A, Takara Bio Inc., Kusatsu, Shiga, Japan) and XhoI (Cat. No.: 1094A, Takara Bio Inc.) and then cloned into the Article Title: Tension-sensitive LINC-RhoA signaling prevents chromatin bridge breakage in cytokinesis Article Snippet: Plasmids pGEX4T1/SRs3-11, pGEX4T1/SRs21-30, pGEX4T1/SRs31-37, pGEX4T1/SRs38-47 and pGEX4T1/SRs48-54 coding, respectively, for spectrin repeats 3–11, 21–30, 31–37, 38–47 and 48–54 of human Nesprin-2 fused to GST were generated by PCR-amplifying the respective sequences from cDNA derived from human BE cells and inserting them into the pGEX4T1 vector (GE Healthcare) as XhoI-NotI fragments. .. Plasmids GFP:PDZ dom , GFP:PDZ(RH), GFP:PDZ(DH/PH) and GFP:PDZ(C-term) coding, respectively, for amino acid sequences 1–219, 220–701, 702–1152 or 1168–1522 of human PDZ RhoGEF fused to GFP were generated by PCR-amplifying the respective sequences from mCitrine-YFP-ARHGEF11 plasmid and inserting them into the Article Title: Spuriously transcribed RNAs from CRISPR-sgRNA expression plasmids scaffold biomolecular condensate formation and hamper accurate genomic imaging Article Snippet: To generate the Streptococcus pyogenes dCas9 expression plasmid pdCas9, the coding region of dCas9 was first PCR amplified from pSLQ1658-dCas9-EGFP, a gift from Dr. Bo Huang and Dr. Stanley Qi (Addgene plasmid #51023) [ ], using forward primer 5′- ACTGCTGCTAGCGCTACCGGTCGCCACCATGGTGCCCAAAAAGAAGAGG-3′ and reverse primer 5′-ACCTGCGAATTCTTAGAACAGCTCCTCGCCC-3′. .. The PCR product was then inserted into the Clone Assay:Article Title: UCHL1-Mediated Spastin Degradation Regulates Microtubule Severing and Hippocampal Neurite Outgrowth. Article Snippet: As a key component of the cytoskeleton, microtubule dynamic provides structural support for neurite outgrowth.. Spastin, a microtubule severing enzyme associated with hereditary spastic paraplegia (HSP), is crucial for the growth and branching of neuronal processes.. Thus, the activity and function of spastin need to be strictly regulated. Article Title: Inhibition of SQSTM1/p62 oligomerization and Keap1 sequestration by the Cullin-3 adaptor SHKBP1 Article Snippet: Reagents were obtained from the following sources: DSP (Dithiobis(succinimidyl propionate)), TCI America (TCD2473); MLN4924, Cayman (15217); MG-132, Selleckchem (S2619); GFP-Trap magnetic agarose, ChromoTek (gtma-20); Protein G Sepharose, BioVision (6511); Ni-NTA agarose, QIAGEN (133203974); Anti-HA magnetic beads, Thermo Scientific (88836); Anti-FLAG magnetic beads, made in-house from NHS magnetic beads, Nacalai USA (TAS8848N1141-10MG) and Anti DYKDDDDK tag, Fujifilm (012-22383); Lipofectamine 2000, Invitrogen (11668019); RNase A, Research Products International (R21750); Puromycin dihydrochloride, Sigma-Aldrich (P8833); Blasticidin S hydrochloride, 10 mg/ml in HEPES buffer, Alfa Aesar (J67216); cOmplete Protease Inhibitor Cocktail, Roche (5056489001); ProLong Diamond Antifade Mountant with DAPI, Thermo Fisher (P36971); Clarity Western ECL Substrate, Bio-Rad (1705061). .. The SHKBP1 cDNA (Gene ID: 92799, a gift from Haiyuan Yu, Cornell University) was cloned into the Article Title: Expression Analysis of Heavy-Chain-Only Antibodies in Cloudy Catshark and Japanese Bullhead Shark Article Snippet: .. The amplified PCR fragments were digested with EcoRI (Cat. No.: 1040A, Takara Bio Inc., Kusatsu, Shiga, Japan) and XhoI (Cat. No.: 1094A, Takara Bio Inc.) and then cloned into the Article Title: Selective induction by statins of FAM134B-mediated sarcoplasmic reticulum (SR)-phagy degrades the SR calcium pump SERCA1 and contributes to myopathy Article Snippet: The coding sequence of mouse SERCA1 was cloned into p3XFlag-CMV-7.1 vector (Sigma) at the NotI/XbaI site to generate pFLAG-SERCA1. .. To generate EGFP-SERCA1 and pmCherry-EGFP-SERCA1 expression plasmids, coding region of mouse SERCA1 was first cloned into the Generated:Article Title: Tension-sensitive LINC-RhoA signaling prevents chromatin bridge breakage in cytokinesis. Article Snippet: Plasmids pGEX4T1/SRs3-11, pGEX4T1/SRs21-30, pGEX4T1/SRs3137, pGEX4T1/SRs38-47 and pGEX4T1/SRs48-54 coding, respectively, for spectrin repeats 3–11, 21–30, 31–37, 38–47 and 48–54 of human Nesprin-2 fused to GST were generated by PCR-amplifying the respective sequences from cDNA derived from human BE cells and inserting them into the pGEX4T1 vector (GE Healthcare) as XhoINotI fragments. .. Plasmids GFP:PDZdom, GFP:PDZ(RH), GFP:PDZ(DH/PH) and GFP:PDZ(C-term) coding, respectively, for amino acid sequences 1–219, 220–701, 702–1152 or 1168–1522 of human PDZ RhoGEF fused to GFP were generated by PCRamplifying the respective sequences from mCitrine-YFP-ARHGEF11 plasmid and inserting them into the Article Title: Tension-sensitive LINC-RhoA signaling prevents chromatin bridge breakage in cytokinesis Article Snippet: Plasmids pGEX4T1/SRs3-11, pGEX4T1/SRs21-30, pGEX4T1/SRs31-37, pGEX4T1/SRs38-47 and pGEX4T1/SRs48-54 coding, respectively, for spectrin repeats 3–11, 21–30, 31–37, 38–47 and 48–54 of human Nesprin-2 fused to GST were generated by PCR-amplifying the respective sequences from cDNA derived from human BE cells and inserting them into the pGEX4T1 vector (GE Healthcare) as XhoI-NotI fragments. .. Plasmids GFP:PDZ dom , GFP:PDZ(RH), GFP:PDZ(DH/PH) and GFP:PDZ(C-term) coding, respectively, for amino acid sequences 1–219, 220–701, 702–1152 or 1168–1522 of human PDZ RhoGEF fused to GFP were generated by PCR-amplifying the respective sequences from mCitrine-YFP-ARHGEF11 plasmid and inserting them into the Expressing:Article Title: Selective induction by statins of FAM134B-mediated sarcoplasmic reticulum (SR)-phagy degrades the SR calcium pump SERCA1 and contributes to myopathy Article Snippet: The coding sequence of mouse SERCA1 was cloned into p3XFlag-CMV-7.1 vector (Sigma) at the NotI/XbaI site to generate pFLAG-SERCA1. .. To generate EGFP-SERCA1 and pmCherry-EGFP-SERCA1 expression plasmids, coding region of mouse SERCA1 was first cloned into the |